Các bệnh thường gặp trên cá chẽm

Cá chẽm (Lates calcarifer), là loài có giá trị kinh tế quan trọng ở các vùng nhiệt đới và cận nhiệt đới thuộc khu vực châu Á - Thái Bình Dương như Úc, Trung Quốc, Indonesia, Malaysia, Thái Lan, Việt Nam và Đài Loan.

Cá chẽm
Cá chẽm là là loài có giá trị kinh tế quan trọng ở các vùng nhiệt đới và cận nhiệt đới. Ảnh: Wikipedia

Nó có khả năng sinh sản cao, có thể chịu đựng được mật độ nuôi dày và nhiệt độ cao, có khả năng phát triển nhanh đến kích thước lớn ở cả nước ngọt và nước mặn. Tuy nhiên, hiện nay trên đối tượng này cũng đã ghi nhận nhiều mầm bệnh xuất hiện và làm thiệt hại đến kinh tế. Một số bệnh truyền nhiễm như bệnh rụng vảy, bệnh hoại tử thần kinh do virus, hoại tử gan và thận, bệnh do vi khuẩn StreptococcosisVibriosis.

Bệnh rụng vảy (SDD - scale drop disease) do một loại virus Megalocytivirus (SDDV - scale drop disease virus) thuộc họ Iridoviridae gây ra đã xuất hiện ở cá chẽm nuôi (Lates calcarifer) tại Singapore, Malaysia, Indonesia và Việt Nam. Bệnh xuất hiện trên cá nuôi thương phẩm trong hệ thống nuôi lồng và nuôi ao. Tỷ lệ chết tích lũy ước tính ảnh hưởng trang trại là khoảng 40%.

Bệnh rụng vảyBệnh rụng vảy do virus Megalocytivirus (SDDV - scale drop disease virus). Ảnh: ciba.icar.gov.in

Chẩn đoán lâm sàng chó thấy bên ngoài có sự bong vảy và đi kèm với da đỏ hoặc xuất huyết ở bề mặt cơ thể, hiện tượng rung này xuất hiện toàn thân của cá. Chẩn đoán dựa vào đặc điểm mô bệnh học thì mô hoại tử, viêm và xuất hiện pyknosis, karyorrhexis ở nhiều cơ quan. Có các thể vùi trong tế bào chất trong mô cơ. Khi quan sát bằng kính hiển vi điện tử (TEM) có các hạt virus hình lục giác, có vỏ bao bọc kích thước khoảng 100–180 nm. Chẩn đoán bằng phương pháp PCR sử dụng đoạn mồi RB-MCP-F1/ATG TCA TCT ATT GCA GGA GC và RB-MCP-R1/TTA CAA GAT CGG AAA TCC AA đặc hiệu cho bệnh rụng vảy do virus, các mẫu bệnh phẩm là các mô của cá có dấu hiệu bệnh lý rụng vảy  bao gồm mắt, não, gan, thận, tỳ tạng, cơ và ruột đều cho kết quả dương tính với SDDV.

Triệu chứng bệnhCá chẽm bị rụng vảy và xuất huyết trên da. Ảnh: MDPI

Ở bệnh này vì hiếm khi quan sát thấy thể vùi virus, nên không thể sử dụng các dấu hiệu lâm sàng và mô bệnh học để chẩn đoán chính xác tác nhân gây bệnh này vì khó thể phân biệt giữa SDD do vi khuẩn hoặc SDD do virus gây ra. Do đó, để chẩn đoán sớm tác nhân gây bệnh cần sử dụng phương pháp PCR để giám sát sàng lọc cá bố mẹ, cá bột và cá thương phẩm và để ngăn chặn sự lây lan dịch bệnh và phát hiện xớm bệnh để đề xuất phương pháp xử lý cụ thể.

Bệnh Streptococcosis

Ở cá chẽm nhiễm bệnh Streptococcosis hay còn gọi là bệnh liên cầu khuẩn, thuộc nhóm vi khuẩn Gram dương. Bệnh do vi khuẩn Streptococcus agalactiaeS. iniae là hai tác nhân gây bệnh chính, trong đó bệnh do S. iniae thường xuất hiện với tỷ lệ cao hơn, bệnh gây chết lên tới 70% ở giai đoạn cá giống. Bệnh xuất hiện ở các trang trại nuôi cá chẽm thuộc các nước Châu Á bao gồm Singapore, Úc, Việt Nam, Thái Lan, Iran và Israel. 

Cá bị nhiễm bệnh có biểu hiện lâm sàng như mất thăng bằng, bơi lội thất thường, lồi mắt một bên hoặc hai bên, giác mạc mờ, da sẫm màu và xuất huyết ở vây. Chẩn đoán mô bệnh học có dấu hiệu viêm xuất huyết ở gan, thận và não, đặc biệt là thâm nhiễm tế bào lympho trong não và thoái hóa gan. Chẩn đoán bằng phương pháp PCR sử dụng đoạn mồi gen mã hóa lactate oxidase (lctO) chuyên biệt cho S. iniae LOX-1 AAGGGGAAATCGCAAGTGCC và LOX-2 ATATCTGATTGGGCCGTCTAA.

Mô bệnh học

Biểu hiện mô bệnh học của cá chẽm nhiễm Streptococcus iniae (não (A, B), thận (C, D) và gan (E, F)

Hiện nay có nhiều nghiên cứu sử dụng vaccine trong phòng hai loại bệnh nêu trên. Cụ thể, vaccine bất hoạt bằng formalin 3% đơn giá hay đa giá S. agalactiae và S. iniae, trong nuôi trồng thủy sản, vaccine bất hoạt hoặc vaccine chết thường được sử dụng do tính ổn định của chúng trong lĩnh vực này và chi phí sản xuất thấp hơn so với các loại vaccine khác. Vaccine đa giá bất hoạt có chứa ISKNV-I và SDDV cũng đã được được phát triển và đánh giá trong điều kiện phòng thí nghiệm với khả năng bảo hộ tuyệt đối ≥86,7% và RPS ≥85,7%.

Nguồn: Senapin, S., Dong, H. T., Meemetta, W., Gangnonngiw, W., Sangsuriya, P., Vanichviriyakit, R., ... & Nuangsaeng, B. (2019). Mortality from scale drop disease in farmed Lates calcarifer in Southeast Asia. Journal of fish diseases, 42(1), 119-127. 

Kayansamruaj, P., Dong, H. T., Nguyen, V. V., Le, H. D., Pirarat, N., & Rodkhum, C. (2017). Susceptibility of freshwater rearing Asian seabass (Lates calcarifer) to pathogenic Streptococcus iniae. Aquaculture Research, 48(2), 711-718. 

Đăng ngày 24/08/2023
Hồng Huyền @hong-huyen

Làm sao để nhận biết tôm thẻ bị bệnh gan?

Trong số các vấn đề sức khỏe mà tôm thường gặp phải, bệnh gan là một trong những vấn đề phổ biến và có thể gây tổn thất lớn đối với nuôi tôm. Tuy nhiên, việc nhận biết triệu chứng của bệnh gan ở tôm có thể không phải là một nhiệm vụ dễ dàng.

Tôm vàng gan
• 09:33 24/05/2024

Tại sao điều trị bệnh trên tôm lại kém hiệu quả?

Việc trị bệnh trong ngành nuôi tôm luôn là một thách thức không nhỏ đối với những người làm trong lĩnh vực này.

Tôm bệnh
• 09:52 10/05/2024

Tình hình tôm chết sớm nghi bệnh mờ đục trên ấu trùng tôm thẻ (TPD)

Theo ghi nhận từ Sở Nông nghiệp và PTNT về việc rà soát, nắm thông tin tình hình tôm nuôi chết sớm nghi do bệnh TPD và triển khai các biện pháp phòng, chống dịch bệnh.

Tôm thẻ
• 10:30 06/05/2024

Xổ ký sinh trùng có ảnh hưởng đường ruột tôm?

Tôm bị ký sinh trùng đường ruột là một vấn đề thường xảy ra ở các ao nuôi tôm, gây ảnh hưởng đến sức khỏe, trưởng thành và năng suất của vụ nuôi.

Đường ruột tôm
• 10:42 08/04/2024

Tép Bạc ra mắt phiên bản mới nhất của dòng máy cho tôm ăn Farmext Feeder F7

Farmext - thương hiệu công nghệ thuỷ sản đến từ Tép Bạc tiếp tục thực hiện hoá mô hình nuôi trồng dễ dàng của mình thông qua sự ra mắt thiết bị tự động cho tôm cá, mang tên Máy cho ăn Farmext Feeder F7.

Máy cho ăn Farmext Feeder F7
• 09:40 29/05/2024

Những ứng dụng của astaxanthin: Sức khỏe và tăng trưởng

Astaxanthin ngày nay rất được chú ý do có nhiều tác dụng sinh lý ở động vật thủy sinh (Lim và cs., 2018; Lu và cs., 2021). Carotenoid có thể thúc đẩy việc sử dụng chất dinh dưỡng hiệu quả, dẫn đến cải thiện hiệu suất tăng trưởng ở nhiều loài thủy sản (Amar và cs., 2001).

Astaxathin
• 09:40 29/05/2024

Cứu hộ rùa biển và các loài thú biển bị đánh bắt ngoài ý muốn

Vừa qua, tại Khu bảo tồn biển Hòn Cau, Tổ chức Bảo tồn thiên nhiên quốc tế ( IUCN) đã phối hợp với Trung tâm Bảo tồn Đa dạng sinh học và Loài nguy cấp (CBES) tổ chức tập huấn hoạt động cứu hộ rùa biển và thú biển bị đánh bắt không chủ đích (bycatch) cho 16 khu bảo tồn biển/vườn quốc gia (KBTB/VQG) và đại diện 28 Chi cục Thủy sản các tỉnh/thành ven biển trên cả nước.

Rùa bị đánh bắt ngoài ý muốn
• 09:40 29/05/2024

Cách sử dụng thuốc tím tắm cho cá trước khi thả

Thuốc tím (KMnO4) là một chất khử trùng phổ biến được sử dụng để tắm cho cá trước khi thả vào bể hoặc hồ mới. Việc này giúp loại bỏ các mầm bệnh trên cá, giảm nguy cơ lây nhiễm bệnh cho cả đàn. Tham khảo bài viết dưới đây để biết được cách sử dụng thuốc tím tắm cho cá trước khi thả nhé!.

Cá nuôi
• 09:40 29/05/2024

Giải thích hiện tượng: Tại sao tôm lại bị cong khi nấu chín?

Tôm là một loại thực phẩm phổ biến và được ưa chuộng trong bữa ăn của nhiều gia đình. Việc nấu tôm đúng cách không chỉ giữ được hương vị thơm ngon mà còn giúp tôm giữ được hình dáng hấp dẫn.

Tôm nấu chín
• 09:40 29/05/2024
Some text some message..